Web-сайт MolBiol.ru
 

English   Deutsche Fassung  Український варіант
[Войти] [Регистрация]
Всё
всего сообщений: 3998   страницы (200): « < 190 191 192 193 194 195 196 > » 

раздел новостей: Конференции Конференция "Биотехнология и бизнес"
17.02.2003 01:38  Anonymous / Redactor           к началу страницы  комментарии: 0
user posted image 21-22 апреля 2003 г. компания ОАО "Биохиммаш" совместно с компанией ООО "Abercade Consulting" проводят Третью Международную Конференцию "Биотехнология и бизнес". Цель конференции: демонстрация действующих проектов в области биотехнологий, механизмов инфраструктуры, реальных возможностей взаимодействия бизнеса и науки.
Более подробная информация - на сайте: www.rusbio.biz
Руководитель проекта
Старкова Юлия Юрьевна
E-mail: conf@rusbio.biz



раздел новостей: Биология Протокол "Сбор полевого материала для ПЦР"
14.02.2003 01:35  Redactor           к началу страницы  комментарии: 0
Новый протокол "Сбор полевого материала для ПЦР" /Владимир А. Чистяков; Ростов-на-Дону/. После фиксации ДНК нормально выделяется как фенол/хлороформным методом, так и солевой экстракцией. Текст подготовлен по материалам обсуждения на Форуме.


раздел новостей: Информация Русификация, перевод, транслит, кодировки
19.01.2003 01:28  Redactor           к началу страницы  комментарии: 0
Практически заново переписана страница "Русификация, транслит, кодировки". Ресурсы, имеющие отношение к проблемам, связанным с русским языком: виртуальная клавиатура, перекодировка с транслита, декодирование нечитаемой почты, русификация компьютера, грамотность, перевод.


раздел новостей: Конференции Лекция "Семейство GFP-подобных белков"
13.01.2003 23:16  Anonymous / Redactor           к началу страницы  комментарии: 0
Лекция "Семейство GFP-подобных белков: свойства, разнообразие и эволюция".
Состоится 16 января 2003 г. в 15:00 в Институте биоорганической химии РАН (ул. Миклухо-Маклая 16/10) в малом зале БОН. Лектор: Михаил Матц. Research Assistant Professor, Whitney Lab, University of Florida. После лекции - интервью с желающими кандидатами на postdoctoral position.

Всеволод Белоусов
belousov@evrogen.ru">belousov@evrogen.ru

Николай Николаевич Мудрик
mudrik@evrogen.ru
www.evrogen.ru
Телефон: 3307056


раздел новостей: Информация Новая программа Форума
22.12.2002 04:02  Redactor           к началу страницы  комментарии: 0
Установлена новая программа Форума. Ниже перечислены её достоинства в порядке убывания. Кроме того, новая программа позволяет ассоциировать с каждым посетителем картинку-образ (avatar). Пока что эта опция заблокирована из-за сомнительной полезности. Но если всем очень захочется...
Просьба. Если заметите какие-нибудь глюки, не сочтите за труд сообщить. Все старые возможности Форума должны были сохраниться.

- всем посетителям -

Опция "версия для печати" на страницах тем user posted image

Кнопка быстрого перехода к новым сообщениям user posted image в теме на странице "новых сообщений" и в верхней части всех тем.

После закрытия темы на Full Text доброго коллегу возвращают на узловую страницу Форума, а не на страницу закрытой темы.

Последние сообщения не "за сутки", а "за последние 24 часа".

В каждом сообщении появилась кнопка user posted image для того, чтобы обратить внимание модератора на интересную тему, конфликт или нарушение правил конференции. Можно написать короткое пояснение. Сообщение будет отправлено модератору по e-mail (NB! сам текст сообщения прикрепится к письму автоматически).

Форма поиска по текущему Форуму в нижней части страницы.

- зарегистрированным участникам -

Появилась возможность использовать нормальный e-mail адрес при регистрации. Теперь можно скрыть его от всех посетителей, но одновременно разрешить присылать письма зарегистрированным участникам через программу Форума. Адрес при этом нигде не появляется. Удобно.

Предварительный просмотр при редактировании и отправке новых сообщений.

Теперь тот, кто нечаянно продублировал сообщение может удалить его самостоятельно.

Как и раньше, сообщения можно редактировать в любое время после создания. Но теперь в течение двух часов после размещения на форуме их можно ещё и удалять (но только со страницы редактирования). Кроме того, при редактировании в течение этих двух часов не ставится приписка "Сообщение отредактировано...".

Закрытый по ошибке запрос на Full Text теперь можно открыть. Очень надеюсь, что это не приведёт к росту количества кривых запросов.

Можно организовывать не только обсуждения, но и голосования. К сожалению, и голосовать, и смотреть результаты могут только зарегистрированные участники. Я попробовал разблокировать эту опцию для всех, но не вышло - программа завязана на регистрацию, так как определяет по ней, не голосовал ли кто-нибудь несколько раз.

В нижней части Форумов теперь перечисляются посетители за последние полчаса. Кому не нравится, что его имя поминается всуе, может заблокировать показ в Личных Данных.

Кроме того, появился целый раздел "Участники", где можно посмотреть, кто принимает участие в Форуме. Можно выводить упорядоченный список или организовывать поиск.


раздел новостей: Информация Третий выпуск Coffee break
22.12.2002 03:53  Redactor           к началу страницы  комментарии: 0
В третий раз на "Весёлую страничку" (Coffee break) выложены забавные истории с форума. Как обычно, они выделены синим цветом. Сейчас новые поступления размещены в начале разделов, так что находить их стало удобнее. Приятного чтения!


раздел новостей: Конференции Онкоиммунология - третье тысячелетие
16.12.2002 03:52  Anonymous / Redactor           к началу страницы  комментарии: 0
Дорогие коллеги, приглашаем вас посетить миникурсы образовательной программы "Онкоиммунология - третье тысячелетие".

23, 24, 26, 27 декабря, 16:00 - prof. Michael Reth (Freiburg University).
.
Кроме того, 25 декабря в 13:00 состоятся специальные рождественские лекции тех же ораторов: "Палео-эпидемиология: "испанка" 100 миллионов лет назад" (А.Гудков) и "Hispanka: the history of the flu pandemie of 1918" (M.Reth). Лекции будут прочитаны в актовом зале ИМБ РАН им.В.А.Энгельгардта (ул.Вавилова 32, м. "Ленинский проспект", "Академическая").
Планируется оцифровка видеозаписей лекций в формате Windows Media Video. Для просмотра потребуется компьютер класса Pentium II / Celeron, Windows Media Player версии 7 или выше и возможность загрузить для него свежие кодеки (т.е. связь с Интернет). Желающие получить копии лекций в таком виде могут заранее приносить пустые CD-R болванки (1 диск на 1-2 лекции).

Дмитрий Купраш
LMI_course@mtu-net.ru
www.oncoimmunology.ru


раздел новостей: Литература Обновление на сайте Бенджамена Льюина
08.12.2002 03:40  Redactor           к началу страницы  комментарии: 0
Бенджамен Льюин уже давно обещал выложить на своём сайте (www.ergito.com) ещё три учебника, кроме всем известного "Genes 2000". Началось. У учебников появились оглавления и выложены главы:
Спешите читать и скачивать пока доступ халявный и требуется только бесплатная регистрация. Скорее всего через некоторое время за это удовольствие будут требовать плату как с Genes 2000 (что бы мы без китайцев сейчас делали?).


раздел новостей: Биология Геномная ДНК из сена
02.12.2002 18:47  Redactor           к началу страницы  комментарии: 0
Дополнение к протоколу "Выделение геномной ДНК из растений" от Елены Ким (kimuch_xx1@mail.ru), магистрантки каф. Цитологии и гистологии СПбГУ. В колонку новостей вынесено из-за того, что я о таком фокусе слышу в первый раз.
Ким Елена, магистрантка каф. Цитологии и гистологии СПбГУ, БИН РАН - лаб. Биосистематики и цитологии.
Если нет жидкого азота, то ткань можно высушить в термостате на +37<sup>o</sup>C (пока она не станет хрупкой), затем перетереть в тонкий порошок в обычной лабораторной ступке диаметром до 10cm с минимальным количеством оксида алюминия (минимальное количество - так чтобы не прилипало к пестику и дну ступки). Для выделения брать около 0.5ml (в 1.5ml пробирке Эппендорф). Если не вся ткань перетерта, хранить её можно при комнатной температуре в новом полиэтиленовом пакетике с пластиковой застежкой.
Этот метод я применяла для широкого спектра растительных объектов в пределах Лилейных, Амариллисовых, Аспарагусовых и пр. В основном использовалась ткань листьев. Выделенная ДНК использовалась для блот/дот-гибридизации, ПЦР.


раздел новостей: Информация Поиск литературы
27.11.2002 18:44  Redactor           к началу страницы  комментарии: 2
На сайт пришло письмо (оно ниже). Так как я сам не знал, зачем нужно искать литературу где-то ещё, кроме обожаемого PubMed, то я попросил Егора сделать сравнительный анализ баз данных и в тот же день (!) получил ответ. Так что:

Добрый день!

Можно было бы сделать форум запросов на библиографический поиск, а то PubMed, доступный в России, насколько я понимаю, включает мало (и для не-молекулярщиков - совсем мало), а тут (напр. - в Принстоне, где я) доступны более прогрессивные - типа Web of Science и Biosis. Человек в России кидает ключевые слова, добрые люди за границей ищут и отсылают (обычно на страницах поисковиков есть кнопка - "отослать результаты"). Хотя, конечно, не больно удобно, но что-то. Попробую подумать, как это можно было бы автоматизировать (сделать робота?) - пока вот просто идея. Не знаю, впрочем, есть ли спрос (если люди в целом довольны pubmed'ом, то большего и не надо) - можно сделать survey на сайте, выяснить.

Егор Базыкин,
yegor_bazykin@mail.ru,
Princeton University [/i][/quote]


раздел новостей: Информация Обзор методов секвенирования
26.11.2002 18:41  Redactor           к началу страницы  комментарии: 0
С месяц назад было объявлено о намерении превратить molbiol.ru в портал. Рад представить первого участника:


Артём подготовил обзор "Методы расшифровки нуклеотидной последовательности фрагментов ДНК" посвящённый эволюции секвенирования от "плюс-минус" метода Ф.Сэнгера и Д.Коулсона (1975) до автоматических секвенаторов (характеристики современных секвенаторов сведены в сравнительную таблицу).


раздел новостей: Конференции Лекции Эдриана Бёрда
25.11.2002 18:33  Anonymous / Redactor           к началу страницы  комментарии: 0
В рамках своего визита в Москву Проф. Эдинбургского Университета Эдриан Бёрд (Adrian Bird) даст две лекции.
Первая лекция
"DNA methylation in sickness and in health" состоится в 17.00 в понедельник 2 декабря в МГУ (аудитория 221 лабораторного корпуса "Б", проезд: М.Университет, Ломоносовский проспект, тролл. 34, авт. 1, 661, 103, 130, до ост. "Ул.Менделеева", далее по ходу автобуса, следующее здание после биофака МГУ, у входа щит с надписью "Факультет биоинформатики", аудитория находится на втором этаже, ссылка на схему проезда, справки по электронной почте: LMI_course@mtu-net.ru).
Вторая лекция
"Functional studies of methyl-CpG binding proteins" состоится в 11.00 во вторник 3 декабря в актовом зале Института Биологии Гена РАН (Москва, ул. Вавилова, 34/5).
Язык лекций -английский. Последние полнотекстовые статьи Проф. Э. Бёрда можно найти на на сайте организаторов лекций Хроматин.Ру.

Организатор лекций: Прохорчук Егор Борисович,
e-mail egorbp@co.ru,
Тел: 095 1354101, Факс: 095 1354105,
www.chromatin.ru


раздел новостей: Литература Web-ссылки на медицинские журналы
25.11.2002 18:29  Redactor           к началу страницы  комментарии: 0
Добавлено более 300 web-ссылок на адреса медико-биологических журналов. В основном ссылки для медиков. Было решено их внести, так как судя по FullText весьма многих интересуют именно медицинские журналы.


раздел новостей: Конференции Лекции С.В.Разина в МГУ
14.11.2002 18:23  Anonymous / Redactor           к началу страницы  комментарии: 0
Лекции С.Разина "Доменная организация эукариотического генома и регуляция экспрессии генов"
Дорогие коллеги,
приглашаем вас посетить лекции С.Разина (Институт биологии гена РАН), которые пройдут 18-20 ноября в МГУ.
Начало в 17:00. Лекции будут читаться в аудитории 221 лабораторного корпуса «Б» Центр молекулярной медицины МГУ. Проезд: М.Университет, Ломоносовский проспект, тролл. 34, авт. 1, 661, 103, 130, до ост. "Ул.Менделеева", далее по ходу автобуса, следующее здание после биофака МГУ. Аудитория находится на втором этаже. Справки по электронной почте: LMI_course@mtu-net.ru
Купраш Дмитрий
LMI_course@mtu-net.ru
Телефон: +7 902 655 0098
www.oncoimmunology.ru


раздел новостей: Литература Издательство W.h. Freeman & Company, раздел "би
12.11.2002 18:09  Redactor           к началу страницы  комментарии: 0
Замечательная ссылка от <Шибато>: W.H. Freeman & Company, раздел "Биология". Во первых, совершенно бесплатно можно скачать две действительно хорошие книги:


user posted image Genetics. A Conceptual Approach; Benjamin Pierce (Baylor U.);



user posted imageImmunology; 5 издание; Richard A. Goldsby, Thomas J. Kindt, Barbara A. Osborne, Janis Kuby.


Почему издательство выложило их бесплатно - понятия не имею.
Во-вторых, имет смысл посмотреть дополнительные материалы к другим книгам.
Почти к каждой книге прилагаются обучающие мультфильмы или интерактивные вопросники. Ниже - фрагмент мультфильма показывающего репликацию ДНК (из книги Molecular Cell Biology; Lodish).

user posted image

В некоторых случаях молекулярные реакции представлены в трёхмерном представлении. Очень впечатлило приложение к третьему изданию "Lehninger Principles of Biochemistry", Lehninger - 3D-Lehninger Principles of Biochemistry. Смотреть можно в Netscape Communicator 4.5-4.7x., кроме того, требуется установить бесплатный plugin Chemscape Chime 2.x (этот plugin вообще полезно иметь на компьютере). Дело того стоит. Молекулярные реакции разъяснены по отдельным шагам. Кроме комментария показывается небольшой мультфильм. Самое приятное, что молекулу на картинке можно по желанию вращать, представлять в виде ленты или объёмных атомов и т.д. и т.п. Попробуйте - не пожалеете. Ниже фрагмент мультфильма, демонстрирующего как рестриктаза EcoRV узнаёт сайт GATATC.
user posted image
И такие красоты - во многих книгах, учись - не хочу! Очень рекомендую.


раздел новостей: Информация Пересчёт рецептов растворов
11.11.2002 18:00  Redactor           к началу страницы  комментарии: 0
На сайте (кроме немецкой и украинской сторон) переписаны все таблицы растворов. Раньше они пересчитывались только по финальному объёму, теперь - по любому компоненту.


раздел новостей: Информация Обновлена "весёлая страничка"
06.11.2002 17:55  Redactor           к началу страницы  комментарии: 0
На "Весёлую страничку" выложена очередная порция историй с форума. Новые истории выделены синим шрифтом. Все истории теперь разбиты по темам:


раздел новостей: Информация Английская сторона сайта - плотности растворов
06.11.2002 17:46  Redactor           к началу страницы  комментарии: 0
На английской стороне вывешены таблицы плотностей солей, растворов кислот, оснований и органических веществ.


раздел новостей: Информация Новые материалы теперь отмечаются на узловых страницах
06.11.2002 17:45  Redactor           к началу страницы  комментарии: 0
На узловых страницах сайта недавно изменённые страницы теперь отмечаются жёлтой лампочкой ( user posted image - как на светофоре: внимание). Порог новизны - 1 месяц. Текст переводится в разряд новых автоматически, при любых изменениях - и больших и маленьких.
По этому поводу изменены некоторые узловые страницы второго уровня. Я не объясняю, что именно сделано, так как изменения чисто композиционные (за исключением разделов "Справочник" и "Литература").


раздел новостей: Софт Программа "случайная последовательность нуклеотидов
06.11.2002 17:41  Redactor           к началу страницы  комментарии: 0
Новая программа: "Случайная последовательность нуклеотидов". Она умеет генерировать случайные последовательности с заданным GC-составом.

> 220 nucleotides; random sequence with 15% GC
TTATGTATATTTTTTAGAAGTTTTAAAGAATAAAAATTTATGCAATATGT
TATCGTTATAATAATAACAGTGTAAAATACCATTAATTTTTATAAAACTT
ATTCGTTAGTATTTATTATATTTTTCAGATAGAATTTAATAAGAATTGTT
TCTTTTAAACTAAGCATTATAATATTTTTGAATAATAGACTATTTATGAT
TATGATTTTCATTTAAATTT

страницы (200): « < 190 191 192 193 194 195 196 > » 
 
Колонка новостей, спонсор — "Диаэм"
компания 'Диаэм' — cпонсор колонки новостей
поиск по каталогу Диаэм
 

  






Каталоги


Объявления





···
···

molbiol.ru для



···
 ·  Викимарт - все интернет-магазины в одном месте  · Doctor Plastic: увеличение груди - в центре Москвы  · 
···






···
 ·  отличный выбор ванны чугунные с доставкой  ·  подмосковн­­ое уполномоче­­нное туристичес­­кое агентство Coral Travel · 
···

 
 
molbiol.ru  ·  redactor@molbiol.ru  ·  реклама

molbiol.ru - методы, информация и программы для молекулярных биологов     Rambler